circad | circRNAs associated with diseases

circRNA_000203
Gene	MYO9A	Organism	Human
Genome Locus	exon 7 to 15 of Myo9a gene	Build	hg19
Disease	Cardiac fibrosis	ICD-10	Myocarditis, unspecified (I51.4)
DBLink	Link to database	PMID	28079129
Experimental Method
Sample Type	Myocardial Tissues	Comparison	myocardium of the 8 matched db/db mice and db/m control mice
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAGAGAAGTACAGATTGCTTCA Reverse CTCTTCTTTAACTTCTAATAATTC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Tang, CM, Zhang, M, Huang, L, Hu, ZQ, Zhu, JN, Xiao, Z, Zhang, Z, Lin, QX, Zheng, XL, -Yang, M, Wu, SL, Cheng, JD, Shan, ZX (2017). CircRNA_000203 enhances the expression of fibrosis-associated genes by derepressing targets of miR-26b-5p, Col1a2 and CTGF, in cardiac fibroblasts. Sci Rep, 7:40342.